Now I'm very excited because I really make the first sequence alignment between microRNA and mRNA myself,that is my first step toward bioinformatics!
microRNA, I'm coming!
Sequences producing significant alignments:
1_ gi|30690802|ref|NM_119856.2| Arabidopsis thaliana AP2 (APETAL... 34 8e-06
>1_ gi|30690802|ref|NM_119856.2| Arabidopsis thaliana AP2 (APETALA 2);
transcription factor AT4G36920 (AP2) mRNA, complete cds
Length = 1642
Score = 34.2 bits (17), Expect = 8e-06
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 77 gagaatcttgatgatgctgca 97
||||||| |||||||||||||
Sbjct: 1350 gagaatcctgatgatgctgca 1330
Subscribe to:
Post Comments (Atom)
No comments:
Post a Comment